Tuesday, February 26, 2013

Ketchum Bigfoot DNA Study - She Said/He Said

Well, here we go again. The second round of attacks have begun. I knew it was only a matter of time. The results of the DNA study and the results of the genomes called into questions by Justin Smeja's claims and the alleged testing results brought forward by Bart Cutino. Again the full and complete genome destroy any claim that can be made that Sample 26 (The Smeja Sample)  was a hunk of bear flesh contaminated with human DNA.

Justin Smeja still maintains he cut a piece off of the flesh he had recovered from the shooting site and sent it to the Ketchum  DNA study. They also maintain that this was the same flesh that was later tested at Trent University with the results being "bear" with human contamination  according to DNA testing done by Trent University.



This is where the "rubber hits the road". The Smeja sample (aka Sample 26)  sent to the Ketchum DNA Study was determined NOT to be human or KNOWN animal (Bear)  by Douglas G. Toler, MD, F.C.A.P. of  Anatomic and Clinical Pathology Huguley Pathology Consultants, P.A. (Supplemental Data 1).

 Below is a excerpt from the Ketchum DNA Study concerning Smeja Sample (Sample 26).
 
A small sample of skin with underlying structures from Sample 26 was submitted to the Texas Veterinary Medical Diagnostic Laboratory at Texas A&M University for the purpose of evaluating the sample for degradation and structure. Subsequently, the slides generated from this examination were submitted to Huguley Pathology Consultants for further evaluation.  A detailed report of the histopathologic findings was generated from the second examination. The report confirmed the Texas A&M findings and revealed that there was little degradation observed and that the structures in the sample were visible and could be reviewed.  There was no pathology present in sample 26, however the histology was deemed inconsistent with human skin. Examination revealed lesser numbers of eccrine glands and even sebaceous gland/pilosebaceous gland units than normally seen in human skin.  Abnormalities such as abortive hair shafts and various alopecias were detected and hair follicle addition or extra follicles, clustered and deeper in the dermal region were noted. The clustering of follicles at a deeper level in the dermis than where most skin appendages usually occur was unusual and not generally associated with hair follicle loss as is seen with alopecia. (Figure 8, Supplementary Data 1)
 
Importantly, histological examination of the skin and tissue sample 26 confirmed that the cells were intact with few bacteria. The absence of contamination or degradation indicates that DNA extracted from this tissue was more than adequate for subsequent DNA sequencing.​​
​
After this determination the sample was sent to the University of Texas where a COMPLETE genome was sequenced from Sample 26. As I documented in a previous post the Q30 score of 88.6 (any score over 80 is considered pure and uncontaminated) proved the sample was not contaminated and from one individual.  This complete genome was then ran against the GenBank Database. A BLAST search takes the genome and compares it to the 300,000 known species stored in GenBank to find a match. There was NO MATCH for the Justin Smeja (Sample 26) sample. 

Justin Smeja claims Dr. Ketchum told him she could manipulate a sample "show anything I want". Then later in the same interview he claims she was going to tell him how to  change the samples DNA composition! According to Smeja here is Dr. Ketchum's formula for changing the structure of the DNA in a sample and making it "be something different than what it is". Here is the formula per Justin Smeja - "mixture of Clorox bleach, formaldehyde or something, some water, acidiat (sic)". So according to Justin Smeja Dr. Ketchum told him that by using this concoction she could change the structure of the DNA and fool both scientific colleagues and  institutions including, UCLA, Texas A&M, and the University of Texas? HOG WASH!!! I think Dr. Toler would have noticed the sample had been manipulated and that the HiSeq 2000 next generation sequencer would have returned a result that was invalid and contaminated.

Again, Justin Smeja's Sample 26 yielded a complete pure genome that had no match in the GenBank database that contains 300,000 known species that exist on this earth. If Dr. Ketchum could manipulate the DNA structure of an ENTIRE GENOME (3 billion base pairs) to fool the University of Texas and the equipment used,  not on 1 but 3 samples, then the criminal justice system is a farce, DNA testing is useless and we need to let anyone out of jail that has ever been convicted using DNA evidence.

I think it more likely for what ever reason Justin Smeja gave Dr. Ketchum a different sample than was tested by Trent University Lab or since Trent University only swabbed the external surface of the "flesh" their testing was not accurate and contaminated.

Either way the Q30 results are the key. I think I will rely on the results from trusted academic institutions, scientist, and the scientific processes that can not be manipulated. I will disregard the nefarious story of Justin Smeja.




34 comments:

  1. You are overstating the importance of the Q-score. The Q-score only deals with base call errors, which are insertions, substitutions, or deletions from the DNA. Base call errors typically result from errors in preparing the samples, not contamination. In other words, it is entirely possible that a sample can have a high Q score and still be contaminated. Let me give you an example. Say your sequence is supposed to look like this:

    ATCGATTGAGCTCTAGCG
    TAGCTAACTCGAGATCGC

    But instead it looks like this:

    AT GATTGAGCTCTAGCG
    TA CTAACTCGAGATCGC

    You'd have a base pair error in that CG was deleted from the third spot. Or you might have a sequence that looks like this:

    ATACGATTGAGCTCTAGCG
    TACGCTAACTCGAGATCGC

    Where AC was inserted into the sequence in the third spot. Or finally, you might have a sequence that looks like this:

    ATCGATTGAGCTCTAGCG
    TATCTAACTCGAGATCGC

    Where CT replaced CG in the third spot.

    These types of errors are most likely to result from errors in the preparation of the samples. They rarely occur due to contamination.

    On the other hand, a contaminant would look like this:

    ATAGATTGAGCTCTTCGCATAT
    TATCTAACTCGAGAAGCGTATA

    In this case, the original sequence is correct, but part of an extra sequence has been added onto the end. A Q30 score would not pick up on this this type of contamination because the base pairs are correct - there's no base pair errors such as AC instead of AT or gaps in the sequence.

    ReplyDelete
    Replies
    1. In essence, Ketchum is misstating what a Q30 score means.

      Delete
    2. Anonymesq, I'm choosing to disregard this very long, very boring, very ordinary attempt to call Dr. Ketchum a liar. Again. Grammy

      Delete
    3. Grammy, sorry if science is boring to you. I happen to find it fascinating. I believe Dr. Ketchum committed bad science. If you believe I am wrong, please explain why. If I made a mistake, I would like to know so that I can learn from it and do not repeat it in the future.

      Delete
    4. Anonymesq: are you claiming to be "Science", personified? Your post is boring. You might or might not have understood whatever it is that you're trying to say. You have certainly failed to understand the general outlook of the commenters on this blog. We are not looking for excuses to slam Dr. Ketchum. That's your mistake.

      Delete
    5. Let me begin again. This is an oversimplified explanation, in hopes of keeping things from getting boring.

      DNA is made up of nucleobases. There are four different kinds of nucleobases, which we call A,T, C, and G. In order to create double helix DNA, these nucleobases pair up, A with T, C with G, T with A, and G with C. Those are the only possible combinations that can occur in nature. Therefore, when we are looking at a DNA sequence, if we see a TC or AG base pair, we know that something is wrong and we screwed up in preparing the sequences.

      Ok, so what does that mean for Ketchum's claims regarding Q scores and contamination?

      Basically, a Q score is obtained by running your data through a computer. The computer looks at the sequence, does a bunch of charts and graphs, adn then runs some really fancy math to figure out how many base pair errors there are in the sequence. The fewer errors, the higher the score. However, the computer only looks for base pair errors like a AG or TC. It cannot tell whether the sequence is contaminated, so long as the contamination base pairs are AT or CG.

      Does that make sense?

      Delete
    6. And grammy, are you saying that it doesn't matter if Ketchum is wrong? That it doesn't matter whether her results are correct, because you like them?

      Delete
    7. Anonymesq: It is fascinating. Now, Ketchum stated that q30 scores can "also" (meaning, she very well knows what they are for) be used to tell whether there was a contamination (or mixture) in the samples sequenced, "according to Illumina", because the contaminated samples do not give such high scores. Now, can you tell us whether you know this to be true?
      Also, can the reported consistent results be blamed on contamination in three samples from three individuals from three locations, sequenced in different labs?

      Delete
    8. Q scores are only used for base pair errors, at least so far as I --and everyone I've talked to -- know. It would be nice if Ketchum had included a reference for that claim, but she did not. None of the material I've reviewed on Illumina's website supports that claim.

      Delete
    9. @Anonymesq Please give url's where you found this info.
      Also, what is your background/training in genetics/forensic science?

      Delete
    10. @Anonymesq So you had to go to Illumina site...talk to people... I, a complete layman, did all that myself. Suppose that means you do not really do sequencing and do not really deal with contaminated samples. Ok, I'll trust the experienced professionals who deal with the actual machines and are in regular contact with the manufacturer and have education and salaries and real names attached. Thank you.

      Delete
    11. @Tighttales, I looked at the Illumina website to confirm that they hadn't decided to suddenly redefine Q scores - if they did, they aren't telling anyone. I checked with others to ensure that forensic labs don't use the phrase "Q score" as shorthand for "Uncontaminated" - no one had heard it in that context. It's called due diligence - I try to avoid talking out of my arse.

      @ Lark, what info are you looking for? If you're looking for a quick overview of what Q-scores actually do, I'd suggest you try http://www.illumina.com/truseq/truth_in_data/quality_scores_data_.ilmn or http://www.illumina.com/truseq/quality_101/quality_scores.ilmn. If you want information about base call errors, you might try http://www.chevreux.org/thesis/node10.html. I suggest Chevreux because he's writing for a more general audience than you might find with peer reviewed journals - he starts off with a nice explanation of how DNA sequences are actually prepared, rather than diving right into "OK, you've got your data, here's a lot of math to see whether it's correct or not."

      Delete
    12. @Anonymesq
      MK used HiSeq 2000 next generation sequencing. She gives as a reference for the quality scores, http://www.illumina.com/Documents/products/technotes/technote_Q-Scores.pdf
      According to this reference,
      Historically used to determine Sanger sequencing accuracy, Phred originated as an algorithmic approach that considered Sanger
      sequencing metrics, such as peak resolution and shape, and linked them to known sequence accuracy through large multivariate lookup tables. ...While next-generation sequencing metrics vary from those of Sanger sequencing (e.g., no electropherogram peak heights), the process of generating a Phred quality scoring scheme is largely the same.
      Parameters relevant to a particular sequencing chemistry are analyzed for a large empirical data set of known accuracy. The resulting quality score lookup tables are used to calculate a quality score for de novo next-generation sequencing data

      This sounds nothing like how you apparently think they generate a quality score. Apparently you think they sequence both strands of the DNA independently and look at % mismatches.
      MK writes
      Q30 can also be used to determine if there was any contamination (or mixture) found in the samples sequenced...if there was contamination present in the sample sequenced, the divergent sequences would compete against one another prior to sequencing causing a contaminated sample to have a Q30 score of 40 to 50.
      MK said the DNA sequencing involved 30x coverage, i.e. each segment of DNA is sequenced about 30 times. Apparently, a consensus sequence is generated from the 30 reads, which tends to correct for contamination. This is why contamination would lower the quality score: there is less certainty about the final sequence, over 30 reads, if there is contamination.
      The site at chevreaux.org is a thesis from 2006 - DNA sequencing technology has changed greatly since then, so it's probably irrelevant.
      MK said she had to find a journal that looked for peer reviewers who were familiar with next-gen sequencing. This might have been for reasons like understanding the quality scores.

      Delete
    13. I don't really see how it sounds different. Illumina's factsheet is written for a technical audience who are familiar with how sequencing works. I was writing for someone who calls herself "grammy" and says DNA is boring. I don't see any contradiction between the two. For instance, peak heights refer to points on the charts and graphs I mentioned. Phred refers to the formula Q = -10log10P (assume the second ten is in subscript) where P stands for the probability of error. That's the math I was referring to.

      Your comment about contamination makes no sense. If the sample is contaminated, that contamination is going to show up no matter how many reads are performed. There are ways to correct for contamination, but they have nothing to do with Q scores. Q scores say "Yes, your sequences don't have errors and you can start working with them." Contamination isn't an error - it's good DNA that shouldn't be there.

      Delete
    14. Sorry but you are WRONG, below is from Robert Lindsay:

      No contamination in Ketchum DNA findings. There is some little-known evidence that there is no contamination in her samples: Ketchum tested the Bigfoot nuDNA for several human genes, the names of which you can find in the manuscript. MC1R (human/Neanderthal red-hair color gene) showed up in the Bigfoot nuDNA as did the human antigen gene TAP1 (most of the time) and the jaw muscle gene MYH16 (which when present showed only a human profile rather than an ape one).

      Not discussed in the manuscript are the tests Ketchum did for the TYR gene, which is associated with skin pigmentation, and the HAR1 gene, which is a “human accelerated region” associated with human neurological development. The human skin color gene TYR and human brain gene HAR1 were not found in Bigfoot nuDNA. Now that in and of itself is very interesting.

      If the samples really were just bear or coyote or bobcat smeared with human contamination, all of the human genes should show up all over the place. The peer-reviewers for Ketchum’s manuscript only wanted positive, not negative, results included for gene tests, so the TYR and HAR1 data are not discussed in the manuscript. However, you can see the remnants of it in the Supplemental Data 12 appendix. The bottom line is the Bigfoot nuDNA is missing some important human genes that should be there if the nuDNA were in fact simply contaminated with human DNA.

      Delete
  2. I am going to keep an open mind and sit on the sidelines and watch this adventure unfold. I don't know if Ketchum's study is true or not , but this is real entertainment.

    ReplyDelete
  3. Anonymesq; Dr. Douglas G. Toler @ Texas A & M does not think Dr. Ketchum is wrong. Huguley Pathology Consultants don't think Dr. Ketchum is wrong. Is your expertise in this field greater than theirs?

    No one can declare her results "wrong" or "right" until the scientific process has been allowed to work. Dr. Ketchum's sequences must be made accessible to other scientists through GenBank. I hope this gets done before I die: I'd like to read about it. Grammy

    ReplyDelete
    Replies
    1. Douglas Toler is at Huguley Pathology Consultants, not Texas A&M. Regardless, I would note that Ketchum is overstating Toler's findings. If you read the letter in Supplementary 1, he does not definitively say that the samples did not come from human or bear -- he says that the samples are unusual for humans, and doesn't even mention bear anywhere that I saw. Again, I think Ketchum is overstating her case and bending the data to reach her desired conclusions.

      Delete
    2. Anonymesq,choosing not to answer several questions and then only clarifying certain ones???Hmmmm
      Suddenly we have a lot of these type posters popping up with the same type of comments here and on other blogs.

      I believe this is what we have going on here...It's very interesting reading especially about the training.

      http://www.sott.net/article/252272-Pay-for-Comments-Confessions-of-a-paid-disinformation-internet-shill

      Quote" My task was simple: I would be assigned to four different websites, with the goal of entering certain discussions and promoting a certain view."


      Be sure to read the whole article has a lot of good information in it. Here's another one...

      http://www.washingtonsblog.com/2012/08/the-15-rules-of-internet-disinformation.html

      Delete
    3. Blondie, thank you. Those are very useful links. Grammy

      Delete
    4. Thanks Blondie for the links! The first one was a great read...............the second one wouldn't link? weird?

      Delete
    5. Beer-Man try goggling any of these items
      How to Spot – and Defeat – Disruption on the Internet | Washington's ...
      Aug 13, 2012 ... The 15 Rules of Web Disruption.

      David Martin's Thirteen Rules for Truth
      Suppression,
      H. Michael Sweeney's 25 Rules of Disinformation

      Delete
  4. Get your facts straight before you post them: Q30 scores do not make any comment on the "purity" of the sample. THey make a comment on the sequences that come out of the testing. It talks about how accurately the sample was read. If the sample contains two contributors and the results include sequences from 2 contributors, the Q30 scores can still be very high, eventhough the interpretation of those results can still be messed up. (That is, someone could still interpret the results as being from a sole contributor.)

    ReplyDelete
  5. also, the pathology on the slides that yo umention - this is little more than a visual examination. It's extremely prone to subjective opinion. Looking at a small piece of dead tissue, and then telling you what animal it came from, with no DNA testing is just not reliable. Also, all teh "hair anomalies" you mention are attributable to the sample NOT being human, and instead being bear.
    As you quote:"histology was deemed inconsistent with human skin"

    ReplyDelete
  6. Shame on you Scott, not only has Ketchum not released any lab reports to substantiate her claims and less then 1% of the data so true comparative analysis cannot be initiated by the scientific community, but you have been completely untruthful here as if it's just ignorance, than you shouldn't be commenting on any aspects of the Sierra Kills event and sample 26.

    This statement below is completely untrue and twists the story as Smeja and his partner NEVER claimed what you say here and the suggestion is impossible if you know anything about reality. I challenge you to find one statement where Smeja has ever claimed to take a piece off the body:

    Scott says "Justin Smeja still maintains he cut a piece off of the flesh he had recovered from the shooting site and sent it to the Ketchum DNA study."

    In addition, you dance around Justin's words as let me quote what she said for you since I heard it 30 minutes after and from 2 other witnesses to the call. This is what she said after he refused to give her the rest of his sample --likely so no one else can ever test it like you insinuate on your blog a week and a half ago as if it's justified telling him to destroy it in some competition in her head with Sykes. Here it is Scott:

    "Justin, if you ever test your sample elsewhere at a "regular" lab you will get a regular animal with contamination. So I need you to destroy the rest of your sample (proceeds to give clorox bleach recipe you tried to justify Scott). If it's money you need I can get Wally to buy the "cleansed" sample and tack on a percentage for myself."

    That's what was said and told to me from day one.

    You can justify that?

    Shame on you and David as Tyler and I have been completely transparent and of course wish the results were different, but the truth matters to us. I even tried to warn David about Dr. ketchum so he wouldn't get blindsided and he repays me by accusing Justin publicly of switching samples (salted sample was out of his custody since July 2011)and insinuates that because I'm in the BFRO I had some influence on the results from these two prominent labs? You guys are unbelievable, what's wrong with you?

    You accuse Justin of sabotaging himself to make himself appear like a hoaxer because he's worried about something prosecution) he's never mentioned to anyone but it gives Ketchum a way out. If he's so worried about prosecution than why not say it was a hoax to escape it fully. Instead he integrates himself into the community and this research. You guys expect people to believe Justin told the truth about the shootings but he's lying about switching pieces? unbelievable. In addition, you think all three of us wouldn't love for her to be right, personal feelings aside? I got thermal footage 250 yds from purported shootings and almost 23 months later, the guy has become a close friend, you think life wouldn't be easier for everybody if sample 26 is in fact from a bigfoot?

    I can go on but you're brainwashed and obviously so emotionally invested that you're willing to lie to your own readers. I challenge you and David to prove one thing I've said is untrue. Thank god her paper is a disaster based on what she's released or she would've poisoned this subject even more including the legitimate idea of bigfoot dna (fake journal and peer review, charging 30$ and pocketing the monies, no lab reports, less then 1% of the data, no support or substantiaton, no support from her own so called co-authors,fake people (Casey Mullins)etc...

    This isn't science, science is about a hypothesis and that's proven through replication. She tried to make the dna fit into her hypothesis and now she's allowing no opportunity for replication to prove her hypothesis. It's the opposite of science.

    Shame on you, her and David

    Here's the true story and history of the Sierra Kills.

    http://www.sierrasiteproject.com/2013/02/history-of-sierra-kills-tissue.html

    ReplyDelete
    Replies
    1. Bart, first I am not a liar! I have "inside" information just like you do. The Kecthum DNA Study is under scientific review AGAIN. If these scientists say it is all crap then I will be glad to admit it and move on.
      I want to address the “lie” you claim I told, when I said the following:
      "Justin Smeja still maintains he cut a piece off of the flesh he had recovered from the shooting site and sent it to the Ketchum DNA study."
      Below is a direct quote from Smeja.
      “Justin Smeja here. The photos that Robert Lindsay posted are indeed photos from the flesh sample recovered from the Sierras that he so generously coined the phrase ''the steak''. It was a part of this same piece of flesh that Melba told us all she did extensive testing on. If you look closely you can even see on one side an obvious cut mark. That is where Melba got her piece. If Mebla takes the time to look back at the flesh sample she received from me the same sample that she once raved about she will realize it lines up exactly with the shape of that cut, she can even look at the pictures she has. There has always only been one flesh sample that is the one in these pictures.”
      NO WHERE did I ever say that the “flesh” came directly from the Bigfoot body! If you read the statement I clearly state “a piece off of the flesh he had recovered from the shooting site”. Is it not true that he returned to the area and found a piece of flesh? Is it not true that this piece of this flesh has been widely reported to possibly be from the Bigfoot he shot? Is it not true that Smeja is saying that the piece of flesh he sent to the Ketchum DNA Study is from the piece he recovered?
      Since we have two totally different results from the DNA Study and the labs you used I take issue with his claim that flesh he sent the DNA study and the flesh you used were the same. I base this one the test results and the information I have received from the people I trust.
      It appears that I must be on target because I am taking alot of FLAK. There is no need to debate because like my article states you will quote your labs, I will quote mine and we will have a stand off. It does no good to argue any more.

      I was not blindly and with stars in my eyes defending the study. I was stating my opinion backed up with facts. There are many in the scientific world that back up Dr. Ketchum's DNA Study.

      I will leave your comments so we can be transparent and I will let the readers decide. By the tone of your comments it appears that you are as "brainwashed and...emotionally invested" as I am.

      Again let me state that I have never lied and will never lie about this or anything else. Just like you, I am relying on information that has been given to me by people I trust and my own research.

      Delete
    2. Hate to add insult to injury but Robert Lindsay has come to the same conclusion I did, does that make him a liar also? He actually looked at the results like I did and pointed out the following:
      "Possible explanation for anomalous Ketchum and Smeja/Cutino results for the Bigfoot steak from the Sierra Kills. The results indicate that the submissions were from two different objects, not a single object. Cutino/Smeja’s results ended up with MtDNA haplotypes A and T2, and Ketchum’s MtDNA results indicate haplotype H1A for Sample 26 (the Sierra Kills Bigfoot steak). Apparently these were two completely different objects being tested. I have no explanation for the anomalous results or why there were two objects when there was said to be only two pieces of a single object." via htp://robertlindsay.wordpress.com/

      Sorry Bart you trusted the wrong person...

      Delete
  7. I'm sure my comments will disappear but you ever want to debate this let me know as it's people like yourself with stars in your eyes and who fail to perform any diligence that make this field and the many good people in it look like idiots and we're all guilty by association of subject. "Truth" should matter more then anything Scott.

    ReplyDelete
    Replies
    1. This comment has been removed by the author.

      Delete
    2. This comment has been removed by the author.

      Delete
    3. Bart, first I am not a liar! I have "inside" information just like you do. The Kecthum DNA Study is under scientific review AGAIN. If these scientists say it is all crap then I will be glad to admit it and move on.
      I want to address the “lie” you claim I told, when I said the following:

      "Justin Smeja still maintains he cut a piece off of the flesh he had recovered from the shooting site and sent it to the Ketchum DNA study."

      Below is a direct quote from Smeja.
      “Justin Smeja here. The photos that Robert Lindsay posted are indeed photos from the flesh sample recovered from the Sierras that he so generously coined the phrase ''the steak''. It was a part of this same piece of flesh that Melba told us all she did extensive testing on. If you look closely you can even see on one side an obvious cut mark. That is where Melba got her piece. If Mebla takes the time to look back at the flesh sample she received from me the same sample that she once raved about she will realize it lines up exactly with the shape of that cut, she can even look at the pictures she has. There has always only been one flesh sample that is the one in these pictures.”

      NO WHERE did I ever say that the “flesh” came directly from the Bigfoot body! If you read the statement I clearly state “a piece off of the flesh he had recovered from the shooting site”. Is it not true that he returned to the area and found a piece of flesh? Is it not true that this piece of this flesh has been widely reported to possibly be from the Bigfoot he shot? Is it not true that Smeja is saying that the piece of flesh he sent to the Ketchum DNA Study is from the piece he recovered?

      Since we have two totally different results from the DNA Study and the labs you used I take issue with his claim that flesh he sent the DNA study and the flesh you used were the same. I base this one the test results and the information I have received from the people I trust.

      It appears that I must be on target because I am taking alot of FLAK. There is no need to debate because like my article states you will quote your labs, I will quote mine and we will have a stand off. It does no good to argue any more.

      I was not blindly and with stars in my eyes defending the study. I was stating my opinion backed up with facts. There are many in the scientific world that back up Dr. Ketchum's DNA Study.

      I will leave your comments so we can be transparent and I will let the readers decide. By the tone of your comments it appears that you are as "brainwashed and...emotionally invested" as I am.

      Again let me state that I have never lied and will never lie about this or anything else. Just like you, I am relying on information that has been given to me by people I trust and my own research.

      Delete
    4. Hate to add insult to injury but Robert Lindsay has come to the same conclusion I did, does that make him a liar also? He actually looked at the results like I did and pointed out the following:
      "Possible explanation for anomalous Ketchum and Smeja/Cutino results for the Bigfoot steak from the Sierra Kills. The results indicate that the submissions were from two different objects, not a single object. Cutino/Smeja’s results ended up with MtDNA haplotypes A and T2, and Ketchum’s MtDNA results indicate haplotype H1A for Sample 26 (the Sierra Kills Bigfoot steak). Apparently these were two completely different objects being tested. I have no explanation for the anomalous results or why there were two objects when there was said to be only two pieces of a single object." via htp://robertlindsay.wordpress.com/

      Sorry Bart you trusted the wrong person...

      Delete
  8. Oh yeah, and the bleach thing - Melba never said THAT was to alter the DNA to look like something else - that was to destroy the sample, make it so no one could genetically identify it.

    ReplyDelete
    Replies
    1. The interview is on the internet and people can listen, I do not think I misquoted him...

      Delete